- 자유 주제로 사용할 수 있는 게시판입니다.
- 토론 게시판의 용도를 겸합니다.
Date 2019/09/19 21:42:41
Name 박진호
Subject 화성연쇄살인사건 범인을 찾은 DNA감정 (수정됨)
DNA도 감정이 있어요. 생명체라구요!
헛소리였구요.

화성연쇄살인범의 유력 용의자가 특정되었다는 소식이 있었어요.

https://news.joins.com/article/23580932
지난 7월 15일경에 사건당시 발견한 증거물에 대해 DNA감정을 의뢰하였고 일치한 DNA를 가진 사람을 찾았다는 내용이에요.
무기징역수라든지, 나이는 50대라든지 이런건 찾아봐서 아실거라 생각되구요.

제가 이번에 설명드릴 것은 DNA감정에 관한 내용이에요.
바이오관련 대가들이 드글한 피지알에서 DNA감정이 뭔지는 대부분 아시겠지만 행여나 모르실 분들을 위해서 미천한 지식을 펼쳐 보겠어요.
왜 그런걸 설명하냐고 물어보면
쉿! 월급을 훔치는 중입니다.

상식적으로도 사람마다 유전자가 다르고 당연히 DNA도 다르니까 지문처럼 다르겠지. 그러니까 같은 DNA를 가진 사람은 없을거아닌가.
그럼 같은 DNA를 찾으면 되겄네.
맞죠. 그렇죠.
근데 DNA는 눈에 안보이는데. 너무 작아서.
그럼 크게 확대하면 되겠네.
그렇네요. 맞네요! 확대!




105433619-1536156902888gettyimages-876570382
그림1) 이제 잘 보이는군요. DNA는 역시 아재들의 국뽕 아이돌이 되게 해준 2017 AMA DNA죠.




DNA를 대충 확대해서 본다면 이렇게 생겼어요.

DNA-Structure1
그림2) 보이시나요. DNA에는 영어가 쓰여있어요. 우리가 영어를 배워야 하는 이유죠.

DNA는 다 아시다시피 꼬여 있는 이중 나선 형태로 되어있죠. 영어로는 Double helix.
그래서 Doublehelix amino nucleic acid가 DNA의 약자입니다 여러분!




DNA 꼬여서 붙어 있는  두가닥의 DNA를 펼쳐서 확대해 놓으면 이런식의 모습이 되는데요.


images
그림3) 뭔가 많이 생략된거 같지만 기분 탓입니다.

저기 보이는 영어 GTCA가  염기서열이죠. 사람마다 저 염기서열이 다 다르니까 저렇게 널어 놓은 다음에 똑같은걸 찾으면 되겠죠.
참 쉽죠.
지금까지 DNA 감정 방법이었어요.



그런데 문제가 있었네요. 사람간의 유전정보 차이가 별로 없다는 거에요.
저와 여러분 그리고 원빈 김태희 사이에 유전정보 일치율은 무려 99.9%
즉 차이라는건 단 0.1%라는 거죠.


img-201906181129454980eb90
그림4) 너와 나의 차이 겨우 0.1%라굿


휴먼의 염기서열 30억개 중 사람간의 차이는 300만개 정도 되겠죠.
그럼 30억개 중에 300만개를 찾아서 비교를 해야 한다는건데 이걸 일일히 비교하는건 느낌상 너무 삽질같지 않나요?

빨리 일 끝내고싶은 휴먼들은 꼼수를 사용합니다. (드워프였다면 그냥 묵묵히 했을텐데)
염기서열을 요래저래 들여다보니 쓸데없이 반복되는 서열이 발견돼요.

GTCAATGCTTG

이렇게 뭔가 의미 있는 느낌으로 가다가 갑자기

AGTAAGTAAGTAAGTAAGTAAGTAAGTAAGTAAGTAAGTAAGTAAGTA

이렇게 AGTA가 계속 몇차례 반복되는거죠.

이런걸 Short tandem repeat라고 부릅니다. 약자로 STR. 짧은 염기서열이 반복적으로 나타나는걸 의미하는거에요.
보다 긴 80~90개의 염기서열이 반복적으로 나타나는 경우도 있는데 이런건 Variable number of tandem repeat라고 해요. 약자로 VNTR.



그럼 이걸로 어떻게 DNA 감정을 하느냐.
사람마다 STR의 길이가 달라요. 어떤 사람은 10개, 어떤 사람은 11개, 어떤 사람은 12개. 이런 STR이 사람의 염색체에 3만개 정도 된다고 해요.
그래서 15개 정도의 STR 부분을 비교하면 99%의 확률로 동일인 식별이 가능하다는 거죠.
뭔가 설명이 어렵네요.



str-med
그림5) 역시 그림이 짱!

STR로 인해 빠른 퇴근이 가능하게 되었어요.




image
그림6) SRT로 인해 빠른 퇴근이 가능하게 되었어요.



그럼 STR의 길이는 어떻게 측정할까요?
원리는 여러분도 다 아실거에요. DNA는 작잖아요. 작아서 안보이니까 확대해요.
DNA를 확대하는 방법이 바로 PCR이죠. PCR이 뭔지는 설명하지 않을게요.
아시는 분은 아시니까 설명할 필요가 없고 모르시는 분은 알고 싶지 않을 거에요.
간략하게는 DNA의 특정부분을 마구마구 복사해서 많이 만든다고 생각하면 돼요.

2
그림7) 국과수 제공

7번 그림 중에 추가로 설명할 부분은 DNA 분석 즉 STR 분석 부분이에요.




junyoung2011-35
그림8) 염색체 중 분석할 STR 위치

위 그림처럼 이미 위치를 알고 있는 STR부분을 PCR로 복사 시켜서 무게를 재는거죠.
6개짜리 STR보다는 7개가 무겁겠고 7개보다는 8개가 무겁겠죠? 무게를 재는 방법은 매우 정밀해서 1개의 염기서열차이도 구분할 수 있답니다.




9660500-orig
그림9) 잠깐! 스크롤을 멈추세욧

혼란 파멸의 그림같지만 전혀 어렵지 않아요.
위에 suspect 1,2가 용의자의 STR결과 evidence가 증거물에서 나온 STR결과에요.
맨 위에 D3S1358 이건 3번 염색체에서 나온 STR이라는 거에요. 뒤에 번호는 STR 고유번호에요. 3번 염색체 내에도 STR이 많으니까요.
옆에 vWA 랑 FGA도 STR 위치를 나타내는 거라 생각하면 돼요. 댓글 보다 보시면 귀인이 설명해 주실거에요.

파란색 그래프와 밑에 있는 숫자가 STR의 길이를 나타내는 거죠.
그래프에 기둥이 두개씩 있는건 우리 염색체가 한쌍씩 있어서죠.
2번 용의자의 STR패턴이 3군데에서 증거물 DNA에서 나온 STR패턴과 일치하네요.
15개에서 모두 일치한다면 빼박캔트겠죠?
참 쉽죠.



지금부터는 조금 다른 얘기를 해볼게요.
지난 7월 경에 증거물에서 나온 STR패턴과 일치한 용의자가 지금 수감되어 있는 그 용의자와 일치하는지는 어떻게 알았을까요.
감옥을 쓱 다니다가 저 사람 DNA 분석해봐 했을까요?

아니죠. 그냥 범죄자 다 해본 거에요.



2010년에 DNA 신원확인정보의 이용 및 보호에 관한 법률에 의해 범죄자들의 DB를 만들게 돼요.

dna-db-crime-res01
그림10) 요즘 핫한 검찰에서 제공해주셨어요.


그래프 올라가는거 보이죠? 나의 주식도 저랬다면.... 아무튼 이렇게 범죄자들 DNA의 STR 정보를 차곡차곡 모아놔요.
저 많은 데이터중에 일치하는 걸 찾는게 어렵냐? 그렇지도 않아요.


str1
그림11)딱 봐도 숫자 몇개 안되잖아요.

저기 보이는 데이터랑 매칭만 시키면 돼요. 2X17 테이블이네요.
물론 휴먼이 하기에는 어렵지만 우리에겐 킹갓 알파고님이 계시니까 순식간에 매칭시켜주실거에요.



하지만  이 데이터베이스가 앞으로 더 확장되어 갈지는 모르겠어요.

https://www.mk.co.kr/news/society/view/2018/09/556299/
DNA법이 위헌 결정 되었다는 기사에요.

현재까지 DNA법은 DNA 시료를 범죄자로부터 채취해 갈 때 서면동의, 거부 시 법원 영장으로 끝났어요.
압수수색 영장 받으면 이 물건 저 물건 다 챙겨가는 것처럼 DNA 정보도 그렇게 했죠.
그런데 헌재에서 재판청구권이 없어서 너무 기본권 침해아니냐라며 올해 말까지만하고 법을 고치든 없애든 하라고 했어요.


결론
#DNA감정 #STR분석 #DNA법 
월급 잘먹었다.
꺼억.

추가) 오류가 있을 수 있는데 댓글 읽으시면 답이 나올거에요.
PCR 기법 발달도 이번 수사에 큰 의미가 있는거 같은데 더 공부하기 싫어서 패스.

통합규정 1.3 이용안내 인용

"Pgr에는 "명문화된 삭제규정"이 반드시 필요한 사람은 안왔으면 좋겠습니다.
법 없이도 사는 사람, 남에게 상처 안주면서 같이 이야기 나눌수 있는 분이면 좋겠습니다."
19/09/19 22:03
수정 아이콘
재미있게 잘 읽었습니다. 중요한건 아니지만 DNA는 DeoxyriboNucleicAcid 입니다. 저 뜻도 뭔가 의미가 있는건가요 혹시?
로즈 티코
19/09/19 22:09
수정 아이콘
(수정됨) 엄청 러프하게 설명드리면, RNA가 RiboNucleicAcid인데 거기서 산소가 하나 빠져서 Deoxy가 접미어로 붙어서 DNA입니다.

https://cdn.technologynetworks.com/tn/images/body/structureofdnaandrna1516884065009.jpg

이 그림에서 왼쪽이 DNA의 주재료, 오른쪽이 RNA의 주재료인데 5시방향을 보시면 O하나 차이가 있습니다.
아르거스의사도
19/09/19 22:10
수정 아이콘
잘 보았습니다. 완벽하게 이해되었네요?
19/09/19 22:17
수정 아이콘
그걸 물은게 아니라 본문에 적으신 Doublehelix amino-가 의미가 있냐고 물은겁니다.
박진호
19/09/19 22:18
수정 아이콘
없어요. 댓글 수집하고 싶었어요. ㅠ
19/09/19 22:19
수정 아이콘
제가 모르는 뭔 뜻이 있는 줄... (아미노가 어디서 나온건지 잠시 고민했어요. 어디지?염기인가?)
헤물렌
19/09/19 22:23
수정 아이콘
원빈과 0.1프로 차이라니 기분이 좋아졌습니다.
땅과자유
19/09/19 22:25
수정 아이콘
엄청난 정성에 감사드립니다
로즈 티코
19/09/19 22:26
수정 아이콘
앗 죄송합니다ㅜㅠ "저 뜻"이라고 적으신걸 deoxy 칭하신건줄로 알아들었네요....
야부키 나코
19/09/19 22:29
수정 아이콘
난 분명 4년내내 PCR을 하고 분자생물학을 배웠는데 왜 완전히 이해를 못하는 것인가.... 내용은 완전 개론 수준인거 같은데...
교수님 인생 최대업적이 국과수시절 강호순을 잡은거라 4년내내 귀에 딱지가 앉도록 썰을 풀었는데....크크크

저도 PCR이 어떻게 발전해서 이번 범인을 잡을 수 있게 해주었나 궁금하네요
아무거나해주세요
19/09/19 22:32
수정 아이콘
거 양반 직업이 뭐요?
19/09/19 22:37
수정 아이콘
아닙니다. 링크까지 주신 자세한 설명 감사합니다. 누군가에겐 도움이 될거에요. ^^
19/09/19 22:50
수정 아이콘
그럼 이제 데이터는 못모으는건가요?
19/09/19 22:55
수정 아이콘
DNA 법이 위헌이라니...
믿기 힘들군요...
범죄자의 인권, 이런건가요?
범죄를 안 저지르면 되는것 아닌가?
초짜장
19/09/19 22:58
수정 아이콘
와! 헬릭스! 어크 팬이라서 들어봤습니다!
네오크로우
19/09/19 23:13
수정 아이콘
와 엄청 작다는 데 저걸 저리 분석하다니 대단하네.........
어? 근데 그거 무게를 잰다고??????
블루레인코트
19/09/19 23:59
수정 아이콘
다행이네요 원빈과 내가 한끗차이라니.. 크크 소문내야지~~~
루트에리노
19/09/20 00:18
수정 아이콘
본인의 소명기회를 제한한다는 점에세 그냥 딱 봐도 위헌 맞아보이는데요...? 채취가 적법하지 않다는게 아니라, 채취 심사 단계에 있어 적법한 소명을 제공할 기회가 없으니 추가라하는 얘기잖아요.

모든 범죄사건에서 채취된 유전자 검식자료에 대해 내 유전자랑 대조해 보겠다는 얘긴데 말이죠. 좀 심하게 말하면 유전자가 뜨는 모든 범죄에 대해 용의선상에 올리겠단 얘기에요. 본인께선 아무 생각 없이 dna자료를 제공할 수 있으세요?

범죄를 안 저지르면 되는것이 아닌가 라고 하는건 형법 얘기할때 아무 의미없는 얘기죠.
19/09/20 00:31
수정 아이콘
PCR 만든사람은 조지아텍/버클리나온 사람인데, 만나봤더니 돌아이류였습니다. 지난달에 세상을 떠났죠.
DNA 확대한 그림에서 더 확대하면 covalent bond랑 H-bonding 나옵니다. ATCG 구조를 원자단위로 보는 일을 하는게 착잡합니다.
19/09/20 00:55
수정 아이콘
그냥 범죄자 다 해 본게 아니라
제보가 들어와서 대조해 본거라고 기사를 읽은것 같은데...
그게 아니라면,
2010년에 범죄자들의 DB를 만들게 되었는데
화성연쇄살인사건 용의자 DNA일치를 이제 알게 된것도 의아하네요.
19/09/20 01:25
수정 아이콘
저는 범죄자, 특히 강력범에 대해서는 인권보장에 대해서 회의적인 입장입니다.
개같이 취급하는건 반대지만, 너무 일반인과 같은 대우를 하는걸 반대합니다.
그것또한 본인의 죄값이라 생각하기 때문에...
사형제도도 찬성하고, 집행도 해야한다고 생각하는 편이고

범죄를 안 저지르면 되는것이 아닌가?
네, 저는 안저지르면 되는거라 생각하고, 강력범죄 저질렀으면 닥치고 평생 개고생 하면서 후회하면서 감옥에 몇십년 썩혀둬야 한다는 입장이에요.
법적인건 저한테 말씀하셔봤자 제가 그쪽 지식이 없으니...
그냥 인간 말종들은 말종답게 대우해 줘야 한다 라고 생각하는 사람도 있다, 이 정도로 생각해 주시면 좋겠습니다
초식성육식동물
19/09/20 08:21
수정 아이콘
돌아이라고 하셔서..찾아보았습니다.
https://namu.wiki/w/PCR

LSD 환각상태에서 힌트를 얻었다니.. 무슨.. 말을.. 어떻게.. 해야할지..
다이버
19/09/20 08:29
수정 아이콘
(수정됨) 잘 읽었습니다. 정말 쉽게 설명해 주셨네요.

헌재 결정 때문에 DNA 채취를 이제 못할 수 있다가 아니라, 오히려 계속할 수 있게 하라는 취지네요.

지금 법은 문제가 있으면 당사자가 불복할 수 있는 절차가 있어야 하는데, 없어서 위헌이고, 이를 그대로 놓으면 DNA채취를 못하게 될 수 있으니, 올해 말까지 불복 절차를 포함하도록 법을 개정하라는 거에요. 현행 법령에서 사용하는 채취 방법이나 다른 문제가 있다는 것도 아니고요.

헌재에서 이렇게 얘기했으면 기한 내 법이 개정될 겁니다.
덴드로븀
19/09/20 08:52
수정 아이콘
PGR 기법은 없나요?
내안에칼있다
19/09/20 08:57
수정 아이콘
이렇게 보니 0.1% 차이가 어마어마 하네요
저랑 원빈 차이라니....
루트에리노
19/09/20 09:24
수정 아이콘
형법에 대해서 그게 완전 쓸모없는 얘깁니다. 범죄자가 범죄자인지 가려내고 벌을 주는게 형법인데, 말씀대로면 용의선상에 오르는 순간부터 죄인으로 확정짓게 됩니다.

그건 오히려 범죄자들을 위하는 길이죠.
화씨100도
19/09/20 10:49
수정 아이콘
침펜지와는 1.6%차이이다
19/09/20 10:54
수정 아이콘
추게로! 잘 읽었습니다. 이해하기 쉽게 설명해주셨네요.
19/09/20 11:24
수정 아이콘
원빈.. 그 명백한 가능성!! 단 0.1% 차이였다니 아깝네요. 한끝에 5억을 태우는 고니를 보는 곽철용의 심정입니다.
19/09/20 11:28
수정 아이콘
지금이라도 진범을 찾을 수 있게 되서 다행이고 오래 묻혀 있던 사건인데 갑자기 경찰이 7월 들어 다시 감정의뢰한 건 좀 의아하네요
19/09/20 11:41
수정 아이콘
최근에 입수한 첩보에 근거하여 감정의뢰했다는 기사를 읽었습니다.
솔로14년차
19/09/20 12:35
수정 아이콘
그러니까 관련 법을 제정하라는 것에 가깝다고 볼 수 있겠죠.
지문만해도 우리나라는 전국민의 열손가락 지문을 모두 채취해두는 걸요.
19/09/21 08:31
수정 아이콘
네, 그런것도 있죠. 아무튼 그때는 젊었을때고, 2002년(욕쟁이중년남)쯤에 한번 보고, 2013년(욕쟁이할배)쯤에 한번 더 만났는데,
와.. 무슨 사람이 거침이 없더군요. F워드 신봉자에 행동도 뇌를 거치지않고 하는것 같던데... 암튼 노벨상 탄분.
목록 삭게로! 맨위로
번호 제목 이름 날짜 조회 추천
공지 [일반] [공지] 자게에 정치 카테고리가 15일 오전 9시 부터 적용됩니다. [50] Camomile 19/06/14 12763 13
공지 [일반] 정치카테고리의 상호 비하/비아냥 표현 제재 관련 공지 [53] 오호 19/07/18 10999 8
공지 [일반] 자유게시판 글 작성시의 표현 사용에 대해 다시 공지드립니다. [13] empty 19/02/25 24728 5
공지 [일반] 통합 규정 2017.5.5. release [3] 유스티스 17/05/05 97476 7
공지 [일반] [필독] 성인 정보를 포함하는 글에 대한 공지입니다 [50] OrBef 16/05/03 184405 24
83154 [일반] [보론] 일본의 정보력과 근대화에 대한 집착 [19] aurelius2056 19/10/17 2056 4
83153 [일반] X같은 대학원, 정승처럼 졸업하기 1 [4] 방과후계약직1166 19/10/17 1166 4
83152 수정잠금 댓글잠금 [정치] 이제부터야말로 조국(정경심 포함)을 지켜야 한다 [82] 이순4761 19/10/17 4761 0
83151 [일반] 펜벤다졸 유행이 시작된지 4주차네요. 짧은 제 생각을 올려봅니다. [20] 그랜즈레미디5161 19/10/17 5161 2
83150 [일반] 잘뽑은 네이버 시리즈 광고 [13] 박진호2499 19/10/16 2499 2
83149 [일반] 설리 씨의 조문을 다녀오며. [6] 엄지3423 19/10/16 3423 20
83148 [일반] (스포)요즘 원피스 다시 보는데 [81] 그때가언제라도4928 19/10/16 4928 3
83147 [일반] 설리처럼 살고싶었다 [15] SigurRos3667 19/10/16 3667 3
83146 [일반] [도서] 이탈리아 만들기(The Pursuit of Italy) [8] aurelius1190 19/10/16 1190 3
83145 [정치] 조국, 정치, 검찰, 언론. [163] theo7553 19/10/16 7553 0
83144 [일반] 개인적으로 적어보는 내 인생 최고의 드라마. 부활(THE RESURRECTION) 2005年 [20] 랜슬롯2866 19/10/16 2866 0
83143 [정치] 조국 사태가 남긴 생각들 (1) - 이철희 의원 [377] bifrost9720 19/10/16 9720 0
83142 [일반] 금리가 0.25% 인하되었습니다. 부동산? 제로금리 시대? [54] 마약남생이6282 19/10/16 6282 1
83141 [일반] [도서] 기독교의 탄생(La naissance du Christianisme) [8] aurelius1390 19/10/16 1390 0
83140 [일반] [역사] 1872년 어느 일본인이 둘러본 프랑스 파리 [49] aurelius5019 19/10/16 5019 9
83139 [정치] 더불어민주당 금태섭 의원의 공수처 설치 반대이유 [267] 미생11869 19/10/16 11869 0
83138 [일반] 운영진에게 격려를 보냅니다. [16] 닭장군2809 19/10/16 2809 27
83137 [일반] X같은 대학원, 정승처럼 졸업하기 [29] 방과후계약직4124 19/10/16 4124 10
목록 이전 다음
댓글

+ : 최근 1시간내에 달린 댓글
+ : 최근 2시간내에 달린 댓글
맨 위로